|
Addgene inc
plko 1 shctr vector Plko 1 Shctr Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plko 1 shctr vector/product/Addgene inc Average 96 stars, based on 1 article reviews
plko 1 shctr vector - by Bioz Stars,
2026-05
96/100 stars
|
Buy from Supplier |
|
Addgene inc
plko 1 shctrl Plko 1 Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plko 1 shctrl/product/Addgene inc Average 93 stars, based on 1 article reviews
plko 1 shctrl - by Bioz Stars,
2026-05
93/100 stars
|
Buy from Supplier |
|
Addgene inc
plko 1 shcontrol shctrl Plko 1 Shcontrol Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plko 1 shcontrol shctrl/product/Addgene inc Average 94 stars, based on 1 article reviews
plko 1 shcontrol shctrl - by Bioz Stars,
2026-05
94/100 stars
|
Buy from Supplier |
|
Addgene inc
plko 1 puro control shctrl Plko 1 Puro Control Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plko 1 puro control shctrl/product/Addgene inc Average 96 stars, based on 1 article reviews
plko 1 puro control shctrl - by Bioz Stars,
2026-05
96/100 stars
|
Buy from Supplier |
|
Addgene inc
plko 1 shctrl puro Plko 1 Shctrl Puro, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plko 1 shctrl puro/product/Addgene inc Average 96 stars, based on 1 article reviews
plko 1 shctrl puro - by Bioz Stars,
2026-05
96/100 stars
|
Buy from Supplier |
|
Addgene inc
control shrna against luciferase shctrl ![]() Control Shrna Against Luciferase Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/control shrna against luciferase shctrl/product/Addgene inc Average 95 stars, based on 1 article reviews
control shrna against luciferase shctrl - by Bioz Stars,
2026-05
95/100 stars
|
Buy from Supplier |
|
Addgene inc
ted dawson rrid addgene 17608 plko 1 shctrl puro target sequence ![]() Ted Dawson Rrid Addgene 17608 Plko 1 Shctrl Puro Target Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ted dawson rrid addgene 17608 plko 1 shctrl puro target sequence/product/Addgene inc Average 96 stars, based on 1 article reviews
ted dawson rrid addgene 17608 plko 1 shctrl puro target sequence - by Bioz Stars,
2026-05
96/100 stars
|
Buy from Supplier |
|
Addgene inc
plko 1 shctrl puro target sequence 5 cctaaggttaagtcgccctcg 3 ![]() Plko 1 Shctrl Puro Target Sequence 5 Cctaaggttaagtcgccctcg 3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plko 1 shctrl puro target sequence 5 cctaaggttaagtcgccctcg 3/product/Addgene inc Average 93 stars, based on 1 article reviews
plko 1 shctrl puro target sequence 5 cctaaggttaagtcgccctcg 3 - by Bioz Stars,
2026-05
93/100 stars
|
Buy from Supplier |
|
Shanghai GenePharma
lentiviral vectors plko.1 ![]() Lentiviral Vectors Plko.1, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/lentiviral vectors plko.1/product/Shanghai GenePharma Average 90 stars, based on 1 article reviews
lentiviral vectors plko.1 - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
Addgene inc
plko 1 scramble shrna shctrl ![]() Plko 1 Scramble Shrna Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plko 1 scramble shrna shctrl/product/Addgene inc Average 92 stars, based on 1 article reviews
plko 1 scramble shrna shctrl - by Bioz Stars,
2026-05
92/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Frontiers in Oncology
Article Title: An inflammation-related gene landscape predicts prognosis and response to immunotherapy in virus-associated hepatocellular carcinoma
doi: 10.3389/fonc.2023.1118152
Figure Lengend Snippet: Validation of expression and tumorigenicity of hub genes. (A) qRT-PCR validation of MEP1A, CCL20, ADORA2B, TNFSF9, ICAM4, and SLC7A2 in HCC and normal plasmas. (B, C) The mRNA expression level of CCL20 and SLC7A2 in HCC cell lines (SMMC7721, Huh7, HepG2, and HCCLM3) and the normal liver cell lines (WLR68, and LO2) was indicated by qRT-PCR assays. (D) The protein and (E) mRNA expression of CCL20 and SLC7A2 was analyzed by western blotting and RT-PCR in stable SMMC-7721 cells expressing-shRNA against luciferase or CCL20 and over SLC7A2. (F) Morphology of HCC cells after knockdown of CCL20 and overexpression of SLC7A2. (G) Tumorigenicity of SMMC7721-shCtrl cells and SMMC7721-shCCL20/overSLC7A2 cells in nude mice. (H) Tumor volume was measured every 3 days after tumor formation in nude mice injected with SMMC7721 cells transfected with shCtrl or shCCL20/overSLC7A2. (I, J) Tumor weight was measured in nude mice injected with SMMC7721 cells transfected with shCtrl or shCCL20/overSLC7A2 after 30 days. *p < 0.05; **p < 0.01; ***p < 0.005; ****p < 0.0001, ns, not significant.
Article Snippet: Full-length SLC7A2 cDNA was synthesized and cloned into the pCS-CG vector (Addgene, Cambridge, MA, USA). shRNA sequences specifically against CCL20 (shCCL20) and
Techniques: Biomarker Discovery, Expressing, Quantitative RT-PCR, Western Blot, Reverse Transcription Polymerase Chain Reaction, shRNA, Luciferase, Knockdown, Over Expression, Injection, Transfection